Skip Navigation
Skip to contents

Intest Res : Intestinal Research

IMPACT FACTOR

Articles

Page Path
HOME > Intest Res > Ahead-of print articles > Article
Original Article Preventive and therapeutic effects of co-administration of Bacteroides thetaiotaomicron and infliximab on dextran sodium sulfate-induced colitis in mice
Sara Ahmadi Badi1,2,*orcid, Hamid Reza Moradi3,*orcid, Ahmad Berimipour4orcid, Shima Shojaie1orcid, Arian Kariman1orcid, Hananeh Tavakoli Aval2orcid, Seyed Amirhesam Seyedi2orcid, Mehdi Davari5orcid, Mohammad Hassan Sohouli1orcid, Shohreh Khatami2orcid, Seyed Davar Siadat5,6orcid, Pejman Rohani1orcid

DOI: https://doi.org/10.5217/ir.2025.00061
Published online: December 12, 2025

1Pediatric Gastroenterology and Hepatology Research Center, Pediatrics Center of Excellence, Children’s Medical Center, Tehran University of Medical Sciences, Tehran, Iran

2Department of Biochemistry, Pasteur Institute of Iran, Tehran, Iran

3Department of Basic Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, Iran

4Department of Biological Sciences and BioDiscovery Institute, University of North Texas, Denton, TX, USA

5Department of Mycobacteriology and Pulmonary Research, Pasteur Institute of Iran, Tehran, Iran

6Microbiology Research Center, Pasteur Institute of Iran, Tehran, Iran

Correspondence to Pejman Rohani, Pediatric Gastroenterology and Hepatology Research Center, Pediatrics Center of Excellence, Children’s Medical Center, Tehran University of Medical Sciences, Keshavarz Blvd, P94M+83H, Tehran 14197 33151,Iran. E-mail: rohanipejmanmd@gmail.com
*These authors contributed equally to this study as first authors.
• Received: April 22, 2025   • Revised: August 6, 2025   • Accepted: August 21, 2025

© 2025 Korean Association for the Study of Intestinal Diseases.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 594 Views
  • 68 Download
  • Background/Aims
    The gut microbiota plays a crucial role in the pathogenesis and treatment of inflammatory bowel diseases (IBD). This study aimed to investigate the effects of active, heat-inactivated, and cell-free supernatant (CFS) forms of Bacteroides thetaiotaomicron, alone or in combination with infliximab, in dextran sodium sulfate (DSS)-induced colitis in mice. Colitis was induced by oral administration of DSS for seven days. B. thetaiotaomicron in its various forms was orally administered at a dose of 1 × 108 CFU prior to and during colitis induction. Infliximab was intraperitoneally injected from days 3 to 5 of DSS exposure. Colitis severity, gene expression, tumor necrosis factor alpha levels, and gut microbiota were assessed by disease activity index, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and qPCR, respectively.
  • Results
    Active B. thetaiotaomicron and its CFS form significantly alleviated colitis symptoms compared to the heat-inactivated form. Furthermore, co-administration of active B. thetaiotaomicron and infliximab significantly modulated the colonic mRNA expression of Ocln, Tff3, Muc2 (upregulated), and Ace2 (downregulated). This combination also exhibited synergistic improvement in colitis severity in treated mice.
  • Conclusions
    These findings underscore the therapeutic potential of B. thetaiotaomicron in IBD, either alone or in combination with infliximab, and support further development of microbiota-based strategies for IBD prevention and treatment.
Inflammatory bowel diseases (IBD), including Crohn’s disease (CD) and ulcerative colitis (UC), are chronic relapsing conditions of the gastrointestinal (GI) tract that cause significant morbidity and a reduced quality of life [1]. The IBD pathogenesis involves complex interactions between genetic predisposition, environmental triggers, immune dysregulation, and gut microbiota imbalance [2]. Among these, gut microbiota dysbiosis has emerged as a key contributor, affecting disease onset, progression, and therapeutic response [3]. The host–microbiota relationship is central to gut homeostasis, particularly through regulation of epithelial barrier function and immune modulation, both of which are disrupted in IBD [4,5].
Multiple factors contribute to maintaining gut barrier integrity, including physical components such as tight junction (TJ) proteins (e.g., zonula occludens-1 [ZO-1; encoded by Tjp1] and occludin [encoded by Ocln]), chemical barriers like mucin 2 (Muc2) and trefoil factor 3 (Tff3), the immune system, and the gut microbiota [6]. It has been well established that the gut microbiota plays a key role in regulating the expression and localization of these gut barrier components. Under symbiotic conditions, a balance exists between pro-inflammatory and anti-inflammatory mediators, supporting the integrity and function of the gut barrier. In contrast, dysbiosis disrupts this balance, contributing to increased intestinal permeability (“leaky gut”) and triggering an enhanced pro-inflammatory response [7]. Alongside microbial imbalance, disruption of mucosal and physical barrier integrity is a hallmark of IBD. MUC2 and TFF3 play key roles in maintaining mucosal protection against luminal insults [8-10]. Altered expression or function of TJs, MUC2, and TFF3, along with inflammatory responses, has been linked to IBD pathogenesis, highlighting these components as potential therapeutic targets modifiable by gut microbiota interventions [11].
Interestingly, angiotensin-converting enzyme 2 (ACE2) expression and activity may also be associated with IBD pathogenesis and treatment. ACE2 is a multifunctional protein serving not only as the main receptor of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to the regulation of GI immunity and gut microbiota composition. This highlights the importance of considering the correlation between ACE2 expression, IBD pathogenesis/treatment, and gut microbiota composition for IBD management [12].
Several studies have reported differences in gut microbiota composition between patients with IBD and healthy individuals, including a reduced abundance of Bacteroides species in IBD [13,14]. Among these, Bacteroides thetaiotaomicron has shown potential benefits in influencing the pathogenesis and clinical outcomes of IBD, as reflected by measures such as the clinical activity index and Mayo endoscopic subscore in UC patients [15]. B. thetaiotaomicron is a key anaerobic member of the gut microbiota, recognized for its role in modulating intestinal inflammation and maintaining barrier function [16]. It impacts host physiology and immune responses by fermenting complex polysaccharides, producing short-chain fatty acids (SCFAs), and interacting with the intestinal epithelium and mucosal immune system [17]. It has been implicated in regulating mucosal immunity, supporting GI homeostasis, and protecting against pathogenic colonization. However, the specific mechanisms by which B. thetaiotaomicron contributes to IBD pathogenesis and therapeutic response are not yet fully understood [18,19].
Tumor necrosis factor alpha (TNF-α) is a key cytokine involved in IBD pathogenesis, contributing to mucosal inflammation and increased gut permeability, often referred to as “leaky gut.” [20] Current treatment strategies for IBD include biological therapies, among which infliximab, a monoclonal antibody, targeting TNF-α remains a cornerstone [21]. This biologic agent has transformed IBD management by inducing and maintaining clinical remission, promoting mucosal healing, and improving patient outcomes [22]. However, a considerable number of patients experience either primary non-response or secondary loss of response to infliximab, underscoring the need for alternative or adjunctive therapies [23].
Given the complex interplay between gut microbiota and both IBD pathogenesis and treatment response, there is increasing interest in exploring microbiota-based interventions. Combining such strategies with conventional pharmacotherapy may offer new avenues for improving outcomes in IBD management.
Therefore, this study aimed to investigate the effects of B. thetaiotaomicron in different forms including active, heat-inactivated, and cell-free supernatant (CFS) administered alone or in combination with infliximab in a dextran sodium sulfate (DSS)-induced murine colitis model. B. thetaiotaomicron forms were delivered by oral gavage for 7 days prior to DSS induction and continued throughout the colitis phase, allowing us to assess both its preventive and therapeutic effects. This design enabled the evaluation of both the direct and indirect actions of B. thetaiotaomicron on colonic inflammation and barrier function, as well as its potential to enhance or complement the effects of a standard IBD biologic therapy. We assessed colitis severity, gut microbiota composition, and the expression of gut barrier-related genes (Muc2, Tff3, Zo1, Ocln), as well as Ace2. By exploring the in vivo mechanisms through which B. thetaiotaomicron influences gut barrier function and inflammation, this study aims to provide new insights into microbiota-based strategies for improving IBD therapy.
1. Bacterial Culture and Preparation of Heat-Inactivated and CFS Forms
Bacteroides thetaiotaomicron CCUG 10774 (also cataloged as ATCC 29148) was cultured on brain heart infusion (BHI) broth and agar (Montreal, QC, Canada) supplemented with hemin (5 μg/mL) (Sigma-Aldrich, St. Louis, MO, USA) and menadione (1 μg/mL) (Sigma-Aldrich) at 37°C under anaerobic conditions (80% N2, 10% CO2, 10% H2) using an Anoxomat MARK II system [24]. To prepare heat-inactivated and CFS forms, B. thetaiotaomicron was anaerobically cultured on supplemented BHI broth until it reached the logarithmic phase, indicated by an optical density at 600 nm (OD₆₀₀) of ≥ 1. To prepare heat-inactivated B. thetaiotaomicron, bacterial culture was centrifuged at 12,000 ×g for 20 minutes at 4°C to harvest fresh pellets, followed by 2 washes with sterile phosphate-buffered saline (PBS). The bacterial suspension was then heat-inactivated at 70°C for 30 minutes. The heat-inactivated B. thetaiotaomicron was plated on BHI-supplemented agar and incubated at 37°C under anaerobic conditions for at least 1 week to confirm loss of viability. The CFS was prepared by filtering the supernatant obtained from centrifuged bacterial cultures through a 0.22 μm pore-size filter (Millipore, Rockville, MD, USA) [24].
2. Animal Experiment
All animal experiments were conducted in accordance with the guidelines of the Animal Experiment Committee of Tehran University of Medical Sciences for the care and use of laboratory mice. The study protocol was approved by the same committee (Approval ID: IR.TUMS.AEC.1401.023). In this study, male C57BL/6 mice aged 6 to 8 weeks were purchased from the Pasteur Institute of Iran (Tehran, Iran). The mice were housed under controlled and standardized conditions during the acclimatization period (12-hour light cycle, 22 to 23°C temperature, 40% humidity), with free access to a standard diet and autoclaved water. After 7 days of acclimatization, mice were placed in autoclaved cages with sterile hardwood chip bedding and assigned to one of the following 9 groups (n =5 per group).
3. DSS-Induced Colitis Mouse Model and Intervention
The study included the following groups: healthy control (CNT), PBS-treated colitis (PBS), active B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), CFS of B. thetaiotaomicron (Bt-CFS), infliximab alone (IFX), infliximab+active B. thetaiotaomicron (IFX/Bt), infliximab+heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS).
Colitis was induced in mice by administering 2.5% DSS (molecular weight 36,000–50,000 Da; DSS 42867, Sigma-Aldrich) in drinking water for 7 consecutive days. In relevant groups, 200 μL PBS containing B. thetaiotaomicron (10⁸ CFU/mL), heat-inactivated B. thetaiotaomicron (10⁸ CFU/mL), or 200 μL CFS was administered orally by gavage daily, starting 7 days before colitis induction and continued throughout the colitis phase. Infliximab was administered via intraperitoneal injection at 5 mg/kg in 200 μL PBS on days 3 to 5 after DSS initiation in the relevant groups. After DSS induction phase, fresh water replaced DSS for an additional 2 days.
On day 16, all mice were anesthetized with ketamine (100 mg/kg, intraperitoneally) and then sacrificed in accordance with institutional ethical guidelines. Colon tissue, blood, and fecal samples were collected. A portion of the colon was fixed in 10% neutral-buffered formalin for histological assessment, while the remaining tissues and fecal samples were snap-frozen in liquid nitrogen and stored at –80°C for subsequent molecular analyses. Blood samples were collected to evaluate cytokine levels. The experimental design is illustrated in Fig. 1.
4. Histological Evaluation and Assessment of Inflammation Severity
At the end of the experimental period, all animals were euthanized, and their colons were carefully excised and measured for length. A portion of the colon tissue was immediately fixed in 10% neutral-buffered formalin. After fixation, tissues were dehydrated through a graded ethanol series, cleared twice in xylene, and embedded in paraffin. Serial transverse sections, 5 μm thick, were prepared using a rotary microtome and mounted on glass slides. The sections were stained with hematoxylin and eosin and examined under a light microscope (OLYMPUS CX-21, Tokyo, Japan) equipped with a TRUECHROME II digital camera for histopathological evaluation and imaging. Histological assessment was conducted in a blinded manner using a semi-quantitative scoring system adapted from Delday et al. [25] to evaluate the severity and extent of colonic inflammation. Four key histological parameters were scored as follows: (1) Severity of Inflammation was graded on a 4-point scale: Grade 0 indicated absence of inflammation; Grade 1 represented slight infiltration of inflammatory cells in the mucosa; Grade 2 denoted moderate infiltration extending into the submucosa; and Grade 3 indicated severe inflammation with dense cellular infiltration; (2) Extent of Inflammation Spread was categorized based on tissue layer involvement: Grade 0 indicated no detectable inflammation; Grade 1 reflected inflammation confined to the mucosal layer; Grade 2 indicated extension into both the mucosa and submucosa; and Grade 3 represented transmural inflammation involving all layers of the intestinal wall; (3) Crypt Damage was evaluated to assess epithelial and glandular integrity: Grade 0 denoted intact crypts; Grade 1 indicated damage limited to the basal one-third of the crypts; Grade 2 corresponded to damage affecting the basal two-thirds; Grade 3 reflected crypts where only the surface epithelium remained intact; and Grade 4 represented complete loss of both crypts and surface epithelium; or (4) Percentage of Tissue Involvement was scored based on the proportion of the colonic tissue section affected by pathological changes: Grade 1 indicated 1%–25% involvement; Grade 2 represented 26%–50%; Grade 3 represented 51%–75%; and Grade 4 represented 76%–100%.
The total histopathological score for each sample was calculated by summing the scores across these 4 parameters, providing a comprehensive index of tissue damage and inflammatory burden. Additionally, the disease activity index (DAI) was used to assess clinical severity of colitis. This index was calculated by evaluating changes in body weight, stool consistency, and the histological findings.
5. Reverse Transcription-Quantitative Polymerase Chain Reaction Analysis
Total RNA from colon was extracted using the RNX-Plus Kit (CinnaGen, Tehran, Iran). The quality of extracted RNA was assessed by 2% agarose gel electrophoresis and their concentration was measured by NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). The genomic DNA was removed using DNase I (Qiagen, Hilden, Germany). According to the manufacturer’s instructions, RNA was reverse-transcribed into cDNA using a cDNA Synthesis Kit (Parstous, Tehran, Iran). Reverse transcription-quantitative polymerase chain reaction (qPCR) was performed using a Rotor-Gene Q MDX system (Qiagen) with SYBR Master Mix (2 ×, Addbio, Seoul, Korea) and specific primers listed in Table 1 [26,27]. PCR conditions were as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 30 seconds. The relative mRNA expression level of Zo-1, Ocln, Tff3, Muc2, and Ace2 was calculated using the 2−ΔΔCT method, with normalization to Ribosomal protein L19 (Rpl19) as the housekeeping reference gene [28].
6. Enzyme-Linked Immunosorbent Assay
After dissection, peripheral blood was collected and transferred into clot-activator tubes. The samples were kept at room temperature for 2 hours to allow complete clotting. Subsequently, they were centrifuged at 1,500 ×g for 10 minutes at 4°C. The separated serum was carefully collected and stored at −80°C until analysis. TNF-α cytokine levels were measured in serum samples using a Mouse TNF-α ELISA (enzyme-linked immunosorbent assay) kit (ZellBio GmbH, Ulm, Germany) according to the manufacturer’s protocol.
7. Analysis of Relative Abundance of Gut Microbiota Members in Fecal Samples
Fresh fecal samples were collected at the end of the experiment in sterile cups, immediately aliquoted into cryotubes, and stored at −80°C. DNA was extracted from each sample using the VirageneDNA Mini Stool Kit (Viragene, Tehran, Iran). The quality of the extracted DNA was assessed by 2% agarose gel electrophoresis, and its concentration was measured using a Nano-Drop spectrophotometer. Extracted DNA samples were stored at −20°C until further analysis. Quantitative real-time PCR (qPCR) was performed in triplicate using the Rotor-Gene Q MDX system (Qiagen) with SYBR Master Mix (2×, Addbio) and specific 16S rRNA primer pairs listed in Table 2 [29-32]. The thermal cycling conditions were as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 20 seconds. To calculate the relative abundance of the major bacterial phyla, Firmicutes and Bacteroidetes, the average the cycle threshold (Ct) values were transformed using a percentage formula as previously described [33]. Additionally, relative quantification of targeted taxa was calculated using the Livak method, with normalization against the Ct value of the universal bacterial 16S rRNA gene [34].
8. Network Construction between Studied Genes and Gut Microbiota Members
To investigate the interplay between gut microbiota, inflammatory pathways, and host gene regulation in colitis, we employed a multi-step text-mining and bioinformatics approach. This analysis was based on the publicly available murine National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) dataset GSE42768, which profiles gene expression in DSS-induced colitis [35]. Differentially expressed genes (DEGs) were identified by comparing colitis and control groups using standard RNA-seq analysis pipelines. A protein- protein interaction network of these DEGs was constructed using the STRING Python API, highlighting key regulatory nodes and immune-related proteins within the inflammatory context [36]. To assess microbial influence on host signaling, we included bacterial species known to be involved in gut homeostasis and IBD, such as B. thetaiotaomicron, Akkermansia muciniphila, and Faecalibacterium prausnitzii. Due to the lack of publicly available murine transcriptomic datasets featuring infliximab treatment combined with microbiota modulation, we employed Python-based literature mining to extract associations between DEGs and microbiota-related pathways. This was performed using PubMed API and NCBI E-utilities to mine indexed scientific literature [37].
9. Statistical Analysis
All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). Data are presented as mean± standard error of the mean. Prior to analysis, all datasets were tested for normality using the Shapiro–Wilk test. For comparisons between 2 groups, an unpaired two-tailed t-test was used for normally distributed data. For comparisons involving more than 2 groups, one-way analysis of variance was used followed by Dunnett’s post hoc test for comparisons to a single control group. Statistically significant differences were considered at P<0.05.
1. Effects of B. thetaiotaomicron Forms and Infliximab on DSS-Induced Colitis
To investigate the anti-inflammatory effects of different forms of B. thetaiotaomicron (active, heat-inactivated, and CFS), alone or in combination with infliximab (IFX), a DSS-induced murine model of colitis was established. Male C57BL/6 mice were pretreated with the respective interventions for 7 days before DSS administration and continued until day 14. Assessment of disease severity using the DAI showed a significant increase in DAI scores and a marked reduction in colon length in the PBS group compared to the CNT, confirming successful induction of colitis. In contrast, treatment with either live B. thetaiotaomicron, CFS, or infliximab alone, as well as their various combinations, led to notable improvements in clinical parameters. The IFX, Bt, IFX/Bt, and IFX/Bt-CFS groups showed the most pronounced reductions in DAI scores and partial to complete restoration of colon length compared to the PBS group (Fig. 2 and Supplementary Table 1).
Histopathological evaluation revealed severe mucosal disruption and epithelial disorganization in most microscopic fields from the PBS and Bt-In groups. Structural disintegration of the colonic crypts was observed in selected fields of the PBS, Bt-In, Bt-CFS, and IFX/Bt-CFS groups. Mild inflammatory infiltration was detected in a limited number of fields within the Bt, Bt-In, IFX, IFX/Bt-In, and IFX/Bt-CFS groups. In contrast, histological sections from the CNT and other treated groups preserved normal mucosal architecture, with no evident signs of crypt damage, epithelial erosion, or inflammatory cell infiltration. These findings collectively suggest that both active and CFS forms of B. thetaiotaomicron, particularly combination of active with infliximab, can effectively attenuate DSS-induced colitis, as evidenced by improved clinical scores and preservation of histological structure (Fig. 2C and D).
2. B. thetaiotaomicron and Infliximab Modulate Colonic Barrier and Ace2 Gene Expression
In this in vivo experiment, the colonic expression of Muc2, Tff3, Ocln, and Zo-1, which are key genes involved in gut barrier integrity, as well as Ace2, was assessed in DSS-induced colitis mice following treatment with active, heat-inactivated, and CFS forms of B. thetaiotaomicron, administered alone or in combination with infliximab. As shown in Fig. 3A and C, colonic mRNA expression of Muc2 and Ocln were significantly decreased in the PBS-treated colitis group compared to the CNT. Despite no improvement in mice receiving the combination of infliximab and B. thetaiotaomicron CFS, increased Muc2 and Ocln expression were observed in all other treatment groups. Notably, a significant upregulation of colonic Muc2 expression was detected in mice receiving active B. thetaiotaomicron and co-administration of B. thetaiotaomicron and infliximab, while colonic Tff3 expression was significantly increased in mice treated with the combination of active B. thetaiotaomicron and infliximab. A significant reduction in colonic Tff3 expression was observed in the PBS-treated colitis group compared to the CNT group. While treatment with active and heat-inactivated B. thetaiotaomicron alone led to a decrease in Tff3 expression, other intervention groups showed increased levels, with a significant upregulation identified in the IFX/Bt (infliximab+active B. thetaiotaomicron) group (Fig. 3B). Although a notable downregulation of colonic Zo1 mRNA expression was observed in the PBS-treated group compared to the CNT group, no significant changes were detected among the treatment groups (Fig. 3D).
Importantly, a significant reduction in colonic Ace2 mRNA expression was observed in the PBS group compared to the CNT group. Interestingly, all treatment groups, including various forms of B. thetaiotaomicron and infliximab, significantly downregulated Ace2 expression relative to PBS (Fig. 3E).
3. Effects of B. thetaiotaomicron Forms and Infliximab on Serum TNF-α level
According to important role of TNF-α in IBD pathogenesis which is inhibited by infliximab, TNF-α concentration in serum under intervention by B. thetaiotaomicron (active, heat-inactivated and CFS) alone and with combination by infliximab was evaluated by ELISA in DSS-induced colitis mice. As shown in Fig. 4, the level of this pro-inflammatory cytokine significantly increased in mice with colitis without intervention, PBS compared to healthy control mice group, CNT. A reduction in TNF-α concentration was observed across all treatment groups compared to the PBS group. Notably, a statistically significant decrease was seen in mice treated with Bt-CFS, IFX, IFX/Bt, and Bt-In, respectively.
4. Alteration of Gut Microbiota Members by B. thetaiotaomicron Forms and Infliximab
The percentage of Firmicutes and Bacteroidetes, and the relative abundance of key gut microbiota members, including A. muciniphila, F. prausnitzii, B. thetaiotaomicron, Lactobacillus spp. were assessed in fecal samples from all experimental groups via qPCR in a DSS-induced colitis mouse model. As shown in Fig. 5A and B, percentage of Firmicutes and Bacteroidetes were respectively decreased and increased in colitis mice without intervention, PBS group, compared CNT mice group. Also active, heat inactivated and CFS forms of B. thetaiotaomicron alone and with combination by infliximab elevated Firmicutes but these impact were not statistically significant.
As shown in Fig. 5C, the relative abundance of Lactobacillus spp. was reduced in all of intervened mice groups compared CNT. The B. thetaiotaomicron relative abundance was markedly elevated in the Bt and Bt-In mice groups compared to both the CNT and PBS controls, confirming successful delivery and colonization of the bacterium. In contrast, the relative abundance of A. muciniphila was significantly decreased in PBS, Bt and Bt-In groups compared to controls. We also observed a significant reduction in the relative abundance of F. prausnitzii in PBS mice compared to healthy controls, CNT group. Notably, mice receiving Bt-In treatment showed an elevation in F. prausnitzii levels, partially restoring the depletion seen in PBS mice. In contrast, the relative abundance of F. prausnitzii was significantly decreased in the Bt-CFS, IFX, IFX/Bt-In, and IFX/Bt-CFS groups.
5. Bioinformatic Analysis of Host-Microbiota Interactions
To explore potential regulatory crosstalk between gut microbiota and host barrier function, we constructed an integrative network linking studied genes (Muc2, Tff3, Ocln, Zo1, and Ace2) with key microbial taxa (Firmicutes, Bacteroidetes, B. thetaiotaomicron, Lactobacillus spp., A. muciniphila, and F. prausnitzii) (Fig. 6). Additional genes implicated in mucosal defense, epithelial signaling, and microbiota-related immunity such as AGR2, CLEC4M, AGT, FOXA1, Tjp1, FCGBP, CXCR4, and DPP4, were incorporated based on STRING database interactions and literature-mined associations using PubMed and NCBI Eutilities. Using Python’s NetworkX package, we visualized directional relationships with arrows indicating regulatory influence. Node colors represent log₂ fold-change values from the GSE42768 DSS-colitis dataset, illustrating gene upregulation (red) or downregulation (blue) during inflammation. Differential expression values (log₂FC) revealed downregulation of epithelial integrity genes like Ocln and Foxa1, and upregulation of Tff3 and Ace2 in DSS-induced colitis. B. thetaiotaomicron was identified as a microbial node influencing Muc2, a critical mucin gene. Importantly, Muc2 was also highly interconnected with Tjp1 (Zo1), Ace2, and Tff3, highlighting its centrality in mucosal defense pathways.
IBD, a chronic GI inflammation, is induced and progresses through complex multifactorial mechanisms, including disrupted interactions between the host and gut microbiota. Additionally, impaired immunity and gut barrier function, both of which are regulated by the gut microbiota, are considered key pathological mechanisms in IBD development. Previous studies have documented a dysbiotic gut microbiota composition in IBD patients, characterized by a reduced abundance of B. thetaiotaomicron, compared to healthy controls [14]. The role of gut microbiota members, including B. thetaiotaomicron, in the modulation of IBD has been reported; however, the underlying mechanisms require further elucidation. Considering the attenuation potential of B. thetaiotaomicron and infliximab, a TNF-α inhibitor, this study aimed to investigate the protective and ameliorative impact of B. thetaiotaomicron in different forms (active, heat-inactivated, and CFS) alone and in combination with infliximab on colitis improvement in DSS-induced colitis mice.
Notably, our findings exhibited the greatest protective and ameliorative effect against colitis in its active form, followed by its CFS and heat-inactivated form, respectively. This result is consistent with previous reports showing that B. thetaiotaomicron ameliorates colitis symptoms in mice with DSS-induced colitis [25]. Furthermore, the effectiveness of lyophilized capsules containing B. thetaiotaomicron in the treatment of CD has also been reported, further supporting its potential as a therapeutic agent in IBD management [38]. In the current study, although the Bt group had a shorter colon length, it showed significantly less histological damage, suggesting that colon shortening may reflect long-term structural changes (like fibrosis), not just active inflammation [39]. In contrast, histology more accurately reflects current inflammatory status. This discrepancy aligns with clinical IBD studies, where histological healing correlates better with remission than gross measures [40,41]. Thus, inflammation may resolve faster than structural recovery.
Infliximab, a chimeric monoclonal antibody targeting TNF-α, exerts therapeutic effects in IBD primarily through neutralization of TNF-α [42]. Consistent with previous studies [43,44], our results show that infliximab treatment effectively alleviates DSS-induced colitis. According to our findings, simultaneous administration of infliximab and active B. thetaiotaomicron further enhances the colitis-ameliorating effects of B. thetaiotaomicron and infliximab in DSS-induced mice. In a study by Agnholt and colleagues, the effect of infliximab on activated T cells in the intestinal mucosa of CD patients was evaluated. Their finding demonstrated that infliximab treatment effectively decreased the levels of pro-inflammatory cytokines, including TNF-α and interferon-γ [25]. In the present study, infliximab administration significantly reduced serum TNF-α levels in DSS-induced colitis mice. Interestingly, while the CFS and heat-inactivated forms of B. thetaiotaomicron alone significantly reduced TNF-α levels, only the combination of infliximab with live B. thetaiotaomicron showed a significant synergistic reduction compared to other combinations. This pattern suggests that the live, metabolically active form of B. thetaiotaomicron may enhance more effectively with infliximab, possibly due to its dynamic interaction with the host immune system in a context where TNF-α signaling has already been pharmacologically dampened. In contrast, inactivated bacteria or CFS lack the viability or complex host-engaging capacity required to exert further anti-inflammatory influence beyond what infliximab achieves alone.
The GI barrier plays an important role in the interaction between the gut microbiota and the host, as well as in the development of inflammatory GI diseases such as IBD. Various factors are involved in modulating gut barrier function, including TJ proteins such as Occludin and ZO-1, as well as mucosal components like Muc2 and TFF3 [45,46]. Accordingly, in the present study, the colonic expression levels of Zo1, Ocln, Muc2, and Tff3 were evaluated in DSS-induced colitis mice following intervention with B. thetaiotaomicron and infliximab. Xu et al. [47] conducted a study demonstrating that TFF3 has the potential to reduce GI barrier permeability [48,49]. TFF3 has been found to suppress the expression of platelet-activating factor, which in turn downregulates certain TJs. In addition, Muc2, the main component of the intestinal mucus layer, plays a crucial role in maintaining gut barrier integrity by preventing direct contact between luminal microbes and the epithelium [50]. Therefore, both TFF3 and Muc2 may serve as promising targets for treating IBD by enhancing mucosal protection and reducing intestinal permeability [47].
Numerous studies have also demonstrated that members of the gut microbiota can enhance gut barrier function by regulating the production of key proteins. For example, Zhao et al. [51] conducted a study to investigate how different dietary protein sources affect the abundance of A. muciniphila and gut barrier integrity in germ-free mice. They showed that a soy protein-based diet reduced the A. muciniphila abundance and the expression level of Muc2 mRNA. However, these effects were reversed by dietary intervention with A. muciniphila supplementation and a chicken protein-based diet [51]. The effects of the probiotic strain Streptococcus thermophilus UASt-09, along with other probiotic strains, were evaluated on the secretion of proteins from goblet cells using the LS174T cell line model. A significant upregulation of MUC2 expression was observed with several strains, including Bifidobacterium animalis subsp. lactis UABla-12, Lactobacillus acidophilus DDS-1, Lactobacillus plantarum UALp-05, and S. thermophilus UASt-09. However, the probiotic strain S. thermophilus UASt-09 showed a particularly strong effect in increasing TFF3 expression compared to the other probiotic strains, indicating its greater potential for modulating gut barrier function [52]. In addition, a reduced incidence of colon tumors and mucosal damage, along with immune modulation and upregulation of MUC2, TFF3, ZO-1, and Occludin, was reported in a DSS/azoxymethane-induced colitis model in mice receiving a symbiotic composed of Lactobacillus gasseri 505 and the prebiotic Cordyceps tricuspidata [53].
Wrzosek et al. [54], demonstrated in gnotobiotic models that B. thetaiotaomicron enhances goblet cell differentiation, mucin-related gene expression, and mucin glycosylation in vivo. These effects were mediated through acetate-induced upregulation of KLF4, a transcription factor mediating goblet cell differentiation. Notably, co-association with F. prausnitzii attenuated these effects, highlighting the importance of interspecies interactions in regulating the mucus barrier. Consistent with this study, our data demonstrated that active B. thetaiotaomicron significantly increased Muc2 expression in the colonic tissue of DSS-induced colitis mice. While the heat-inactivated and CFS forms of B. thetaiotaomicron increased the expression of the studied genes, these effects were not statistically significant. We identified a significant colonic upregulation of Tff3 and Muc2 in mice receiving combination of active B. thetaiotaomicron and infliximab.
On the other hand, Balanced mucin production and degradation, regulated by the gut microbiota, is essential for digestive and immune homeostasis. Disruption of this balance contributes to GI disorders like IBD. B. thetaiotaomicron exhibits a remarkable ability to degrade glycans such as mucin, which not only facilitates its survival but also provides a competitive nutrient source and supports effective colonization. This capability is primarily attributed to its polysaccharide utilization loci (PULs) [55,56]. Ndeh et al. [57] provided a remarkable functional characterization of B. thetaiotaomicron, identifying specific PULs that are inducible by mucin and involved in the degradation of colonic MUC2. In this context, we observed an upregulation of colonic Muc2 expression in response to active B. thetaiotaomicron compared to the heat-inactivated and CFS forms.
Han et al. [58] reported that Lactobacillus gasseri KBL697, in combination with infliximab, improved DSS-induced colitis in an animal model by reducing inflammatory cytokine levels and enhancing the expression of genes related to gut barrier function, such as ZO-1. In this study, we observed that the combination of active B. thetaiotaomicron and infliximab significantly enhanced the colonic expression of Muc2, Tff3, and Ocln in DSS-induced colitis mice. These findings suggest that coadministration potentiated the individual effects of B. thetaiotaomicron and infliximab, leading to a more effective upregulation of genes involved in gut barrier function. This may emphasize the impact of B. thetaiotaomicron to enhance infliximab efficacy particularly in IBD patients with secondary loss of infliximab response.
Recently, the role of ACE2, the host receptor for SARS-CoV-2, in the regulation of GI immunity and responses to anti-TNF-α therapy, particularly during the COVID-19 pandemic, has gained increasing attention. We also previously discussed the tripartite interplay between ACE2, gut microbiota, and host immunity in the context of COVID-19 [59]. In addition, we reported the downregulatory effects of several gut microbiota members, including A. muciniphila, F. prausnitzii, Bacteroides fragilis, and B. thetaiotaomicron, on ACE2 expression in Caco-2 cells [60]. There is contradictory evidence regarding the role of ACE2 in colitis. For example, a study reported that ACE2 deficiency increased susceptibility to intestinal inflammation in mice with trinitrobenzene sulphonic acid- or DSS-induced colitis [61]. In contrast, several studies have reported downregulation of ACE2 in the small intestine of patients with CD, and upregulation of ACE2 in the colonic tissue of patients with UC, both of which appear to be modulated by anti-TNF-α therapy. Elevated colonic ACE2 expression has been associated with increased inflammation and disease severity in IBD patients compared to healthy controls [12]. Accordingly, colonic mRNA expression of Ace2 was evaluated in DSS-induced colitis mice in comparison with healthy controls. All forms of B. thetaiotaomicron (active, heat-inactivated, and CFS), as well as infliximab alone and in combination, exhibieffects notable downregulatory effects on Ace2 expression. Our findings are consistent with studies reporting that administration of an ACE2 inhibitor, GL1001, ameliorated DSS-induced colitis severity. Furthermore, other research has shown that infliximab treatment downregulates elevated colonic ACE2 expression in patients with IBD [62,63]. It is worth noting that ACE2 may have dual functions in IBD: it acts as a protective factor by countering the renin-angiotensin system, while also potentially exerting deleterious effects by metabolizing the anti-inflammatory and tissue-repairing factors ghrelin and apelin, respectively [64]. Due to its dual role in IBD pathogenesis and in COVID-19 (serving as a viral entry receptor or as a counter-regulator of the deleterious arm of the renin-angiotensin system [59], modulation of ACE2 in IBD patients may influence both intestinal inflammation and susceptibility to SARS-CoV-2 infection. However, the clinical significance of ACE2 regulation in this context requires further elucidation.
However, emerging evidence also suggests that the gut microbiota not only contributes to IBD pathogenesis but may also influence the efficacy of therapeutic strategies [65]. The beneficial effect of Bifidobacterium longum CECT 7894 in enhancing infliximab efficacy has been reported in DSS-induced colitis mice, primarily through modulation of gut microbiota composition and bile acid metabolism [66]. In the current study, a synergistic effect was observed between B. thetaiotaomicron and infliximab in the treatment of colitis, demonstrating that the bacterium may enhance the therapeutic efficacy of infliximab. In our study, DSS-induced colitis led to a decreased Firmicutes and increased Bacteroidetes ratio, consistent with dysbiosis commonly observed in IBD. Among interventions, heat-inactivated B. thetaiotaomicron most effectively restored Firmicutes levels, while infliximab alone best reduced Bacteroidetes. Despite better restoration of A. muciniphila and F. prausnitzii by CFS and heat-inactivated B. thetaiotaomicron, respectively, the live bacterium, particularly when combined with infliximab, demonstrated stronger protection and improvement of colitis. This discrepancy may be attributed to microbial competition or niche dynamics. Importantly, microbiota-targeted interventions including B. thetaiotaomicron act through both compositional and functional changes, including the production of metabolites and structural components, PULs activity, and other functional pathways [56,57,67]. This is consistent with our bioinformatics analysis, which revealed a strong correlation between B. thetaiotaomicron and gut barrier–regulating genes, particularly Muc2, in agreement with our experimental data.
The limitations of this study include the focus on a single, well-characterized strain of B. thetaiotaomicron (CCUG 10774). While our findings demonstrate its potential in modulating inflammation and gut barrier function, it is important to acknowledge that other strains of the same species may differ in their genomic content, metabolic activity, or immunomodulatory properties. Further research comparing multiple B. thetaiotaomicron isolates and also polymicrobial models would be valuable to better understand strain-specific effects and their implications for IBD therapy. Another limitation is the use of an acute DSS-induced colitis model, which—although widely accepted—does not fully capture the chronic and immune-mediated characteristics of human IBD, particularly in CD and UC. Our experimental design primarily models the acute inflammatory phase mimics the flare ups and active inflammatory of IBD. While this was suitable for assessing early therapeutic responses to IFX and B. thetaiotaomicron, further research in chronic or relapsing colitis models and also in IBD patients with secondary loss of infliximab response would provide deeper insight into long-term effects and treatment durability. These future investigations will be important to support the translation of our findings into clinical trials and real-world IBD treatment settings.
In conclusion, considering the importance of the role of gut microbiota, including B. thetaiotaomicron, in the histopathology and treatment of IBD, it is crucial to underscore the effects of B. thetaiotaomicron in different forms—active, heat-inactivated, and CFS—on colitis improvement, the expression of genes involved in regulating gut barrier function, as well as the effects of treatment methods such as infliximab. In conclusion, the present study observed a greater potential of the active and CFS forms of B. thetaiotaomicron compared to the heat-inactivated form in improving colitis caused by DSS in an animal model. Additionally, the combination of infliximab and active B. thetaiotaomicron demonstrated a synergistic effect, resulting in the greatest improvement in colitis severity compared to either treatment alone. This effect was related to the induction of gene expression involved in gut barrier function, as well as histopathological scores. Thus, our data underscore the promise of B. thetaiotaomicron as a microbiota-based adjuvant in IBD therapy, particularly for improving infliximab efficacy in patients with secondary loss of response, warranting further mechanistic investigation.

Funding Source

The authors received no financial support for the research, authorship, and/or publication of this article.

Conflict of Interest

No potential conflict of interest relevant to this article was reported.

Data Availability Statement

Data is available upon request from the corresponding author for the article due to privacy/ethical restrictions.

Author Contributions

Conceptualization: Rohani P, Siadat SD, Badi SA. Data curation: all authors. Formal analysis: Rohani P, Siadat SD, Badi SA. Methodology: Rohani P, Siadat SD, Badi SA. Supervision: Rohani P, Siadat SD. Writing - original draft: all authors. Writing - review & editing: all authors. Approval of final manuscript: all authors.

Additional Contributions

This study is taken from the IBD registry program in infants at Tehran University of Medical Sciences. We are thankful to Dr Pejman Rohani, head of the IBD pediatric registry at Tehran University of Medical Sciences.

Supplementary materials are available at the Intestinal Research website (https://www.irjournal.org).

Supplementary Table 1.

Disease Activity Index
ir-2025-00061-Supplementary-Table-1.pdf
Fig. 1.
Study design and treatment timeline in DSS-induced colitis mouse model. Colitis was induced with 2.5% DSS in drinking water for 7 days (days 8–14). Bacteroides thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) interventions were administered daily by oral gavage from day 1 to 16. Infliximab (5 mg/kg) was given intraperitoneally on days 10, 11, and 12. On day 16, mice were euthanized, and colon, blood, and fecal samples were collected for further analyses. IP, intraperitoneal; D, day; DSS, dextran sodium sulfate; CFS, cell-free supernatant.
ir-2025-00061f1.jpg
Fig. 2.
Impact of active, heat-inactivated and CFS forms of Bacteroides thetaiotaomicron and infliximab co-administration on the improvement of DSS-induced colitis in mice. (A) Colon length, (B) weight loss, (C) representative H&E-stained transverse sections of the colon from the experimental groups. Severe mucosal damage, epithelial disorganization (black arrows), and inflammatory cell infiltration were prominent in the phosphate-buffered saline (PBS) and heat-inactivated B. thetaiotaomicron (Bt-In) groups. Structural disruption of colonic crypts (white arrows) was observed in selected microscopic fields from the PBS, Bt-In, B. thetaiotaomicron CFS (Bt-CFS), and infliximab (IFX)/Bt-CFS groups. Mild infiltration of inflammatory cells (white arrowheads) was noted in limited fields of the Bt, Bt-In, IFX, IFX/Bt-In, and IFX/Bt-CFS groups. Other treatment groups maintained intact mucosal and crypt architecture with no evident histopathological abnormalities. Scale bar=200 μm (×100). (D) Histopathological scores quantifying inflammation severity, crypt damage, extent of inflammation, and tissue involvement across the study groups. The significant results are shown as ***P<0.001. CNT, healthy control; CFS, cell-free supernatant; DSS, dextran sodium sulfate; H&E, hematoxylin and eosin.
ir-2025-00061f2.jpg
Fig. 3.
Impact of active, heat-inactivated, and CFS forms of Bacteroides thetaiotaomicron and infliximab co-administration on colonic expression of Muc2, Tff3, Ocln, Zo1, and Ace2 in DSS-induced colitis mice. Mice were pretreated with B. thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) 7 days before DSS-induced colitis and continued until the end of experiment. Total RNA was extracted from colon tissues, and mRNA expression level of (A) Muc2, (B) Tff3, (C) Ocln, (D) Zo1, and (E) Ace2 were assessed by RT-qPCR and normalized to Rpll9 as the internal control. Healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. The significant results are shown as *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. CFS, cell-free supernatant; DSS, dextran sodium sulfate; SEM, standard error of the mean.
ir-2025-00061f3.jpg
Fig. 4.
Changes in TNF-α serum concentration in DSS-induced colitis mice following different interventions. Mice were pretreated with Bacteroides thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) 7 days before DSS-induced colitis and continued until the end of experiment. Serum levels of TNF-α were measured by ELISA in healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+ heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. The significant results are shown as *P<0.05, **P<0.01, ***P<0.001. TNF-α, tumor necrosis factor α; DSS, dextran sodium sulfate; CFS, cell-free supernatant; ELISA, enzyme-linked immunosorbent assay; SEM, standard error of the mean.
ir-2025-00061f4.jpg
Fig. 5.
Alteration of key gut microbiota by active, heat-inactivated, and CFS forms of Bacteroides thetaiotaomicron and infliximab in DSS-induced colitis. (A, B) Percentage of Firmicutes and Bacteroidetes phyla in fecal samples from different groups: in healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. (C) Heat map showing the log10-transformed relative abundance of B. thetaiotaomicron, Akkermansia muciniphila, Faecalibacterium prausnitzii, and Lactobacillus spp. across treatment groups. Darker blue represents lower abundance and red indicates higher abundance across studied groups. The significant results are shown as *P<0.05, **P<0.01. CFS, cell-free supernatant; DSS, dextran sodium sulfate; SEM, standard error of the mean.
ir-2025-00061f5.jpg
Fig. 6.
Integrative host–microbiota interaction network in dextran sodium sulfate (DSS)-induced colitis. The network illustrates interactions between differentially expressed host genes and key gut microbiota members based on dataset GSE42768 and literature mining. Nodes represent genes (circles) and microbial taxa (rounded nodes), with arrows indicating predicted regulatory or associative interactions. Node colors reflect log2 fold change (log2FC) in colitic versus control mice: red denotes upregulation, blue denotes downregulation.
ir-2025-00061f6.jpg
Table 1.
Oligonucleotide Primers Used in RT-qPCR in Mice
Target gene Forward primer designation Reverse (5`-3`) Product size (bp) Reference
Muc2 CTACATTGACAACTACCACTG TTGTTCACCTGTACCTCCAC 138 This study
Tff3 AATGTCAGAGTGGACTGTGG AATGTGCATTCTGTCTCCTG 131 This study
Ace2 CAAACTCTATGCTGACTGAG AGAAGTTGTCCATTGTGACC 123 This study
Ocln TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG 129 [26]
Zo1 GCCGCTAAGAGCACAGCAA GCCCTCCTTTTAACACATCAGA 172 [26]
Rpll9 CCTGAAGGTCAAAGGGAATGTGTT GCTTTCGTGCTTCCTTGGTCTTA 143 [27]

RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Table 2.
16S rRNA Gene-Specific Primers Used for the Gut Microbiota Analysis
Target gene Primer designation Oligonucleotide sequence (5`-3`) Reference
Universal Forward ACTCCTACGGGAGGCAGCAGT [29]
Reverse ATTACCGCGGCTGCTGGC
Firmicutes Forward TGAAACTYAAGGAATTGACG [30]
Reverse ACCATGCACCTGTC
Bacteroidetes Forward AAACTCAAAKGAATTGACGG [30]
Reverse GGTAAGGTTCCTCGCGCTAT
Akkermansia muciniphila Forward CAGCACGTGAAGGTGGGGAC [30]
Reverse CCTTGCGGTTGGCTTCAGAT
Faecalibacterium prausnitzii Forward GGAGGAAGAAGGTCTTCGG [30]
Reverse AATTCCGCCTACCTCTGCACT
Bacteroides thetaiotaomicron Forward GGCAGCATTTCAGTTTGCTTG [31]
Reverse GGTACATACAAAATTCCACACGT
Lactobacillus spp. Forward AGCAGTAGGGAATCTTCCA [32]
Reverse ATTYCACCGCTACACATG
  • 1. Song X, Huang Q, Yang Y, et al. Efficient therapy of inflammatory bowel disease (IBD) with highly specific and durable targeted Ta2 C modified with chondroitin sulfate (TACS). Adv Mater 2023;35:e2301585.ArticlePubMed
  • 2. De Vos M, Dewit O, D’Haens G, et al. Fast and sharp decrease in calprotectin predicts remission by infliximab in anti-TNF naïve patients with ulcerative colitis. J Crohns Colitis 2012;6:557–562.ArticlePubMed
  • 3. Huang YJ, Marsland BJ, Bunyavanich S, et al. The microbiome in allergic disease: current understanding and future opportunities-2017 PRACTALL document of the American Academy of Allergy, Asthma & Immunology and the European Academy of Allergy and Clinical Immunology. J Allergy Clin Immunol 2017;139:1099–1110.ArticlePubMedPMC
  • 4. Shan Y, Lee M, Chang EB. The gut microbiome and inflammatory bowel diseases. Annu Rev Med 2022;73:455–468.ArticlePubMed
  • 5. Di Vincenzo F, Del Gaudio A, Petito V, Lopetuso LR, Scaldaferri F. Gut microbiota, intestinal permeability, and systemic inflammation: a narrative review. Intern Emerg Med 2024;19:275–293.ArticlePubMedPDF
  • 6. Zhou Y, Zhang D, Cheng H, et al. Repairing gut barrier by traditional Chinese medicine: roles of gut microbiota. Front Cell Infect Microbiol 2024;14:1389925.ArticlePubMedPMC
  • 7. Souza RF, Caetano MA, Magalhães HI, Castelucci P. Study of tumor necrosis factor receptor in the inflammatory bowel disease. World J Gastroenterol 2023;29:2733–2746.ArticlePubMedPMC
  • 8. Yao D, Dai W, Dong M, Dai C, Wu S. MUC2 and related bacterial factors: therapeutic targets for ulcerative colitis. EBioMedicine 2021;74:103751.ArticlePubMedPMC
  • 9. Liu J, Yang Q, Chen Z, et al. TFF3 mediates the NF-κB/COX2 pathway to regulate PMN-MDSCs activation and protect against necrotizing enterocolitis. Eur J Immunol 2021;51:1110–1125.PubMed
  • 10. Liu Y, Yu X, Zhao J, Zhang H, Zhai Q, Chen W. The role of MUC2 mucin in intestinal homeostasis and the impact of dietary components on MUC2 expression. Int J Biol Macromol 2020;164:884–891.ArticlePubMed
  • 11. Yao Q, Fan L, Zheng N, et al. 2’-Fucosyllactose ameliorates inflammatory bowel disease by modulating gut microbiota and promoting MUC2 expression. Front Nutr 2022;9:822020.ArticlePubMedPMC
  • 12. Potdar AA, Dube S, Naito T, et al. Altered intestinal ACE2 levels are associated with inflammation, severe disease, and response to anti-cytokine therapy in inflammatory bowel disease. Gastroenterology 2021;160:809–822.e7.ArticlePubMed
  • 13. Matsuoka K, Kanai T. The gut microbiota and inflammatory bowel disease. Semin Immunopathol 2015;37:47–55.ArticlePubMedPDF
  • 14. Zhou Y, Zhi F. Lower level of Bacteroides in the gut microbiota is associated with inflammatory bowel disease: a meta-analysis. Biomed Res Int 2016;2016:5828959.ArticlePubMedPMCPDF
  • 15. Nomura K, Ishikawa D, Okahara K, et al. Bacteroidetes species are correlated with disease activity in ulcerative colitis. J Clin Med 2021;10:1749.ArticlePubMedPMC
  • 16. Jia W, Xie G, Jia W. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat Rev Gastroenterol Hepatol 2018;15:111–128.ArticlePubMedPDF
  • 17. Lloyd-Price J, Arze C, Ananthakrishnan AN, et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 2019;569:655–662.PubMedPMC
  • 18. Lai Y, Hayashi N, Lu TK. Engineering the human gut commensal Bacteroides thetaiotaomicron with synthetic biology. Curr Opin Chem Biol 2022;70:102178.ArticlePubMed
  • 19. Liu H, Shiver AL, Price MN, et al. Functional genetics of human gut commensal Bacteroides thetaiotaomicron reveals metabolic requirements for growth across environments. Cell Rep 2021;34:108789.ArticlePubMedPMC
  • 20. Meyer F, Wendling D, Demougeot C, Prati C, Verhoeven F. Cytokines and intestinal epithelial permeability: a systematic review. Autoimmun Rev 2023;22:103331.ArticlePubMed
  • 21. Peyrin-Biroulet L, Arkkila P, Armuzzi A, et al. Comparative efficacy and safety of infliximab and vedolizumab therapy in patients with inflammatory bowel disease: a systematic review and meta-analysis. BMC Gastroenterol 2022;22:291.ArticlePubMedPMCPDF
  • 22. Gibson DJ, Ward MG, Rentsch C, et al. Review article: determination of the therapeutic range for therapeutic drug monitoring of adalimumab and infliximab in patients with inflammatory bowel disease. Aliment Pharmacol Ther 2020;51:612–628.ArticlePubMedPDF
  • 23. Gil-Candel M, Gascón-Cánovas JJ, Urbieta-Sanz E, Rentero-Redondo L, Onteniente-Candela M, Iniesta-Navalón C. Comparison of drug survival between infliximab and adalimumab in inflammatory bowel disease. Int J Clin Pharm 2020;42:500–507.ArticlePubMedPDF
  • 24. Ahmadi Badi S, Moshiri A, Ettehad Marvasti F, Mojtahedzadeh M, Kazemi V, Siadat SD. Extraction and evaluation of outer membrane vesicles from two important gut microbiota members, Bacteroides fragilis and Bacteroides thetaiotaomicron. Cell J 2020;22:344–349.PubMed
  • 25. Delday M, Mulder I, Logan ET, Grant G. Bacteroides thetaiotaomicron ameliorates colon inflammation in preclinical models of Crohn’s disease. Inflamm Bowel Dis 2019;25:85–96.ArticlePubMed
  • 26. Ashrafian F, Shahriary A, Behrouzi A, et al. Akkermansia muciniphila-derived extracellular vesicles as a mucosal delivery vector for amelioration of obesity in mice. Front Microbiol 2019;10:2155.ArticlePubMedPMC
  • 27. Brown ML, Kimura F, Bonomi LM, Ungerleider NA, Schneyer AL. Differential synthesis and action of TGFß superfamily ligands in mouse and rat islets. Islets 2011;3:367–375.ArticlePubMedPMC
  • 28. Ahmadi Badi S, Tavakoli Aval H, Moradi HR, et al. Comparative study of liver injury protection by Akkermansia muciniphila and Faecalibacterium prausnitzii interventions in live and cell-free supernatant forms via targeting the hepcidin: ferroportin axis in mice with CCl₄-induced liver fibrosis. Gut Pathog 2025;17:54.PubMedPMC
  • 29. Clifford RJ, Milillo M, Prestwood J, et al. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS One 2012;7:e48558.ArticlePubMedPMC
  • 30. Ettehad Marvasti F, Moshiri A, Taghavi MS, et al. The first report of differences in gut microbiota composition between obese and normal weight Iranian subjects. Iran Biomed J 2020;24:148–154.ArticlePubMedPDF
  • 31. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol 1996;62:1242–1247.ArticlePubMedPMCPDF
  • 32. Alioua S, Abdi A, Fhoula I, Bringel F, Boudabous A, Ouzari IH. Diversity of vaginal lactic acid bacterial microbiota in 15 Algerian pregnant women with and without bacterial vaginosis by using culture independent method. J Clin Diagn Res 2016;10–DC23-DC27.Article
  • 33. Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol 2004;70:7220–7228.ArticlePubMedPMCPDF
  • 34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402–408.ArticlePubMed
  • 35. Breynaert C, Dresselaers T, Perrier C, et al. Unique gene expression and MR T2 relaxometry patterns define chronic murine dextran sodium sulphate colitis as a model for connective tissue changes in human Crohn’s disease. PLoS One 2013;8:e68876.ArticlePubMedPMC
  • 36. Szklarczyk D, Kirsch R, Koutrouli M, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 2023;51–D638-D646.ArticlePDF
  • 37. Sayers E. A general introduction to the E-utilities. In: Entrez Programming Utilities Help [Internet]. National Center for Biotechnology Information; 2022. https://www.ncbi.nlm.nih.gov/books/NBK25497/pdf/Bookshelf_NBK25497.pdf.
  • 38. Hansen R, Sanderson IR, Muhammed R, et al. A double-blind, placebo-controlled trial to assess safety and tolerability of (thetanix) Bacteroides thetaiotaomicron in adolescent Crohn’s disease. Clin Transl Gastroenterol 2020;12:e00287.ArticlePubMedPMC
  • 39. Li J, Dejanovic D, Zangara MT, Chandra J, McDonald C, Rieder F. Mouse models of intestinal fibrosis. Methods Mol Biol 2021;2299:385–403.ArticlePubMedPMC
  • 40. Christensen B, Erlich J, Gibson PR, Turner JR, Hart J, Rubin DT. Histologic healing is more strongly associated with clinical outcomes in ileal Crohn’s disease than endoscopic healing. Clin Gastroenterol Hepatol 2020;18:2518–2525.e1.ArticlePubMed
  • 41. Christensen B, Hanauer SB, Erlich J, et al. Histologic normalization occurs in ulcerative colitis and is associated with improved clinical outcomes. Clin Gastroenterol Hepatol 2017;15:1557–1564.e1.ArticlePubMedPMC
  • 42. Marzo M, Felice C, Rapaccini GL, et al. Infliximab: a review of its use in the treatment of inflammatory bowel disease. Clin Med Insights Ther 2011;3:S1978.ArticlePDF
  • 43. Zhong G, Shi R, Chen Q, et al. Metabolomics reveals the potential metabolic mechanism of infliximab against DSS-induced acute and chronic ulcerative colitis. Naunyn Schmiedebergs Arch Pharmacol 2024;397:8815–8824.ArticlePubMedPDF
  • 44. Lopetuso LR, Petito V, Cufino V, et al. Locally injected Infliximab ameliorates murine DSS colitis: differences in serum and intestinal levels of drug between healthy and colitic mice. Dig Liver Dis 2013;45:1017–1021.ArticlePubMed
  • 45. Gieryńska M, Szulc-Dąbrowska L, Struzik J, Mielcarska MB, Gregorczyk-Zboroch KP. Integrity of the intestinal barrier: the involvement of epithelial cells and microbiota: a mutual relationship. Animals (Basel) 2022;12:145.ArticlePubMedPMC
  • 46. Wells JM, Brummer RJ, Derrien M, et al. Homeostasis of the gut barrier and potential biomarkers. Am J Physiol Gastrointest Liver Physiol 2017;312–G171-G193.Article
  • 47. Xu LF, Teng X, Guo J, Sun M. Protective effect of intestinal trefoil on injury of intestinal epithelial tight junction induced by platelet activating factor. Inflammation 2012;35:308–315.ArticlePubMedPDF
  • 48. Corfield AP. The interaction of the gut microbiota with the mucus barrier in health and disease in human. Microorganisms 2018;6:78.ArticlePubMedPMC
  • 49. Hanning N, Edwinson AL, Ceuleers H, et al. Intestinal barrier dysfunction in irritable bowel syndrome: a systematic review. Therap Adv Gastroenterol 2021;14:1756284821993586.ArticlePubMedPMCPDF
  • 50. Kang Y, Park H, Choe BH, Kang B. The role and function of mucins and its relationship to inflammatory bowel disease. Front Med (Lausanne) 2022;9:848344.ArticlePubMedPMC
  • 51. Zhao F, Zhou G, Liu X, et al. Dietary protein sources differentially affect the growth of Akkermansia muciniphila and maintenance of the gut mucus barrier in mice. Mol Nutr Food Res 2019;63:e1900589.ArticlePubMedPDF
  • 52. Shastri MD, Chong WC, Vemuri R, et al. Streptococcus thermophilus UASt-09 upregulates goblet cell activity in colonic epithelial cells to a greater degree than other probiotic strains. Microorganisms 2020;8:1758.ArticlePubMedPMC
  • 53. Oh NS, Lee JY, Kim YT, Kim SH, Lee JH. Cancer-protective effect of a synbiotic combination between Lactobacillus gasseri 505 and a Cudrania tricuspidata leaf extract on colitis-associated colorectal cancer. Gut Microbes 2020;12:1785803.ArticlePubMedPMC
  • 54. Wrzosek L, Miquel S, Noordine ML, et al. Bacteroides thetaiotaomicron and Faecalibacterium prausnitzii influence the production of mucus glycans and the development of goblet cells in the colonic epithelium of a gnotobiotic model rodent. BMC Biol 2013;11:61.ArticlePubMedPMCPDF
  • 55. Johansson ME, Sjövall H, Hansson GC. The gastrointestinal mucus system in health and disease. Nat Rev Gastroenterol Hepatol 2013;10:352–361.ArticlePubMedPMCPDF
  • 56. Sonnenburg ED, Zheng H, Joglekar P, et al. Specificity of polysaccharide use in intestinal bacteroides species determines diet-induced microbiota alterations. Cell 2010;141:1241–1252.ArticlePubMedPMC
  • 57. Ndeh DA, Nakjang S, Kwiatkowski KJ, et al. A Bacteroides thetaiotaomicron genetic locus encodes activities consistent with mucin O-glycoprotein processing and N-acetylgalactosamine metabolism. Nat Commun 2025;16:3485.ArticlePubMedPMCPDF
  • 58. Han DH, Kim WK, Lee C, et al. Co-administration of Lactobacillus gasseri KBL697 and tumor necrosis factor-alpha inhibitor infliximab improves colitis in mice. Sci Rep 2022;12:9640.ArticlePubMedPMCPDF
  • 59. Ahmadi Badi S, Tarashi S, Fateh A, Rohani P, Masotti A, Siadat SD. From the role of microbiota in gut-lung axis to SARS-CoV-2 pathogenesis. Mediators Inflamm 2021;2021:6611222.PubMedPMC
  • 60. Ahmadi Badi S, Malek A, Paolini A, et al. Downregulation of ACE, AGTR1, and ACE2 genes mediating SARS-CoV-2 pathogenesis by gut microbiota members and their postbiotics on Caco-2 cells. Microb Pathog 2022;173:105798.ArticlePubMedPMC
  • 61. Hashimoto T, Perlot T, Rehman A, et al. ACE2 links amino acid malnutrition to microbial ecology and intestinal inflammation. Nature 2012;487:477–481.ArticlePubMedPMCPDF
  • 62. Byrnes JJ, Gross S, Ellard C, Connolly K, Donahue S, Picarella D. Effects of the ACE2 inhibitor GL1001 on acute dextran sodium sulfate-induced colitis in mice. Inflamm Res 2009;58:819–827.ArticlePubMedPDF
  • 63. Li XZ, Qiu Y, Jeffery L, et al. Down-regulation of colonic ACE2 expression in patients with inflammatory bowel disease responding to Anti-TNF therapy: implications for COVID-19. Front Med (Lausanne) 2020;7:613475.ArticlePubMed
  • 64. Ferreira-Duarte M, Estevinho MM, Duarte-Araújo M, Magro F, Morato M. Unraveling the role of ACE2, the binding receptor for SARS-CoV-2, in inflammatory bowel disease. Inflamm Bowel Dis 2020;26:1787–1795.ArticlePubMedPDF
  • 65. Lavelle A, Sokol H. Gut microbiota-derived metabolites as key actors in inflammatory bowel disease. Nat Rev Gastroenterol Hepatol 2020;17:223–237.ArticlePubMedPDF
  • 66. Xiao F, Dong F, Li X, et al. Bifidobacterium longum CECT 7894 Improves the efficacy of infliximab for DSS-induced colitis via regulating the gut microbiota and bile acid metabolism. Front Pharmacol 2022;13:902337.ArticlePubMedPMC
  • 67. Durant L, Stentz R, Noble A, et al. Bacteroides thetaiotaomicron-derived outer membrane vesicles promote regulatory dendritic cell responses in health but not in inflammatory bowel disease. Microbiome 2020;8:88.ArticlePubMedPMCPDF

Figure & Data

REFERENCES

    Citations

    Citations to this article as recorded by  

      • PubReader PubReader
      • ePub LinkePub Link
      • Cite
        CITE
        export Copy Download
        Close
        Download Citation
        Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

        Format:
        • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
        • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
        Include:
        • Citation for the content below
        Preventive and therapeutic effects of co-administration of Bacteroides thetaiotaomicron and infliximab on dextran sodium sulfate-induced colitis in mice
        Close
      • XML DownloadXML Download
      Figure
      • 0
      • 1
      • 2
      • 3
      • 4
      • 5
      Preventive and therapeutic effects of co-administration of Bacteroides thetaiotaomicron and infliximab on dextran sodium sulfate-induced colitis in mice
      Image Image Image Image Image Image
      Fig. 1. Study design and treatment timeline in DSS-induced colitis mouse model. Colitis was induced with 2.5% DSS in drinking water for 7 days (days 8–14). Bacteroides thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) interventions were administered daily by oral gavage from day 1 to 16. Infliximab (5 mg/kg) was given intraperitoneally on days 10, 11, and 12. On day 16, mice were euthanized, and colon, blood, and fecal samples were collected for further analyses. IP, intraperitoneal; D, day; DSS, dextran sodium sulfate; CFS, cell-free supernatant.
      Fig. 2. Impact of active, heat-inactivated and CFS forms of Bacteroides thetaiotaomicron and infliximab co-administration on the improvement of DSS-induced colitis in mice. (A) Colon length, (B) weight loss, (C) representative H&E-stained transverse sections of the colon from the experimental groups. Severe mucosal damage, epithelial disorganization (black arrows), and inflammatory cell infiltration were prominent in the phosphate-buffered saline (PBS) and heat-inactivated B. thetaiotaomicron (Bt-In) groups. Structural disruption of colonic crypts (white arrows) was observed in selected microscopic fields from the PBS, Bt-In, B. thetaiotaomicron CFS (Bt-CFS), and infliximab (IFX)/Bt-CFS groups. Mild infiltration of inflammatory cells (white arrowheads) was noted in limited fields of the Bt, Bt-In, IFX, IFX/Bt-In, and IFX/Bt-CFS groups. Other treatment groups maintained intact mucosal and crypt architecture with no evident histopathological abnormalities. Scale bar=200 μm (×100). (D) Histopathological scores quantifying inflammation severity, crypt damage, extent of inflammation, and tissue involvement across the study groups. The significant results are shown as ***P<0.001. CNT, healthy control; CFS, cell-free supernatant; DSS, dextran sodium sulfate; H&E, hematoxylin and eosin.
      Fig. 3. Impact of active, heat-inactivated, and CFS forms of Bacteroides thetaiotaomicron and infliximab co-administration on colonic expression of Muc2, Tff3, Ocln, Zo1, and Ace2 in DSS-induced colitis mice. Mice were pretreated with B. thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) 7 days before DSS-induced colitis and continued until the end of experiment. Total RNA was extracted from colon tissues, and mRNA expression level of (A) Muc2, (B) Tff3, (C) Ocln, (D) Zo1, and (E) Ace2 were assessed by RT-qPCR and normalized to Rpll9 as the internal control. Healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. The significant results are shown as *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. CFS, cell-free supernatant; DSS, dextran sodium sulfate; SEM, standard error of the mean.
      Fig. 4. Changes in TNF-α serum concentration in DSS-induced colitis mice following different interventions. Mice were pretreated with Bacteroides thetaiotaomicron (at different forms, active, heat-inactivated, and CFS) 7 days before DSS-induced colitis and continued until the end of experiment. Serum levels of TNF-α were measured by ELISA in healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+ heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. The significant results are shown as *P<0.05, **P<0.01, ***P<0.001. TNF-α, tumor necrosis factor α; DSS, dextran sodium sulfate; CFS, cell-free supernatant; ELISA, enzyme-linked immunosorbent assay; SEM, standard error of the mean.
      Fig. 5. Alteration of key gut microbiota by active, heat-inactivated, and CFS forms of Bacteroides thetaiotaomicron and infliximab in DSS-induced colitis. (A, B) Percentage of Firmicutes and Bacteroidetes phyla in fecal samples from different groups: in healthy mice (CNT), phosphate-buffered saline (PBS), B. thetaiotaomicron (Bt), heat-inactivated B. thetaiotaomicron (Bt-In), B. thetaiotaomicron CFS (Bt-CFS), infliximab (IFX), infliximab+B. thetaiotaomicron (IFX/Bt), infliximab+heat-inactivated B. thetaiotaomicron (IFX/Bt-In), and infliximab+B. thetaiotaomicron CFS (IFX/Bt-CFS). Data represent the mean±SEM. (C) Heat map showing the log10-transformed relative abundance of B. thetaiotaomicron, Akkermansia muciniphila, Faecalibacterium prausnitzii, and Lactobacillus spp. across treatment groups. Darker blue represents lower abundance and red indicates higher abundance across studied groups. The significant results are shown as *P<0.05, **P<0.01. CFS, cell-free supernatant; DSS, dextran sodium sulfate; SEM, standard error of the mean.
      Fig. 6. Integrative host–microbiota interaction network in dextran sodium sulfate (DSS)-induced colitis. The network illustrates interactions between differentially expressed host genes and key gut microbiota members based on dataset GSE42768 and literature mining. Nodes represent genes (circles) and microbial taxa (rounded nodes), with arrows indicating predicted regulatory or associative interactions. Node colors reflect log2 fold change (log2FC) in colitic versus control mice: red denotes upregulation, blue denotes downregulation.
      Preventive and therapeutic effects of co-administration of Bacteroides thetaiotaomicron and infliximab on dextran sodium sulfate-induced colitis in mice
      Target gene Forward primer designation Reverse (5`-3`) Product size (bp) Reference
      Muc2 CTACATTGACAACTACCACTG TTGTTCACCTGTACCTCCAC 138 This study
      Tff3 AATGTCAGAGTGGACTGTGG AATGTGCATTCTGTCTCCTG 131 This study
      Ace2 CAAACTCTATGCTGACTGAG AGAAGTTGTCCATTGTGACC 123 This study
      Ocln TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG 129 [26]
      Zo1 GCCGCTAAGAGCACAGCAA GCCCTCCTTTTAACACATCAGA 172 [26]
      Rpll9 CCTGAAGGTCAAAGGGAATGTGTT GCTTTCGTGCTTCCTTGGTCTTA 143 [27]
      Target gene Primer designation Oligonucleotide sequence (5`-3`) Reference
      Universal Forward ACTCCTACGGGAGGCAGCAGT [29]
      Reverse ATTACCGCGGCTGCTGGC
      Firmicutes Forward TGAAACTYAAGGAATTGACG [30]
      Reverse ACCATGCACCTGTC
      Bacteroidetes Forward AAACTCAAAKGAATTGACGG [30]
      Reverse GGTAAGGTTCCTCGCGCTAT
      Akkermansia muciniphila Forward CAGCACGTGAAGGTGGGGAC [30]
      Reverse CCTTGCGGTTGGCTTCAGAT
      Faecalibacterium prausnitzii Forward GGAGGAAGAAGGTCTTCGG [30]
      Reverse AATTCCGCCTACCTCTGCACT
      Bacteroides thetaiotaomicron Forward GGCAGCATTTCAGTTTGCTTG [31]
      Reverse GGTACATACAAAATTCCACACGT
      Lactobacillus spp. Forward AGCAGTAGGGAATCTTCCA [32]
      Reverse ATTYCACCGCTACACATG
      Table 1. Oligonucleotide Primers Used in RT-qPCR in Mice

      RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

      Table 2. 16S rRNA Gene-Specific Primers Used for the Gut Microbiota Analysis


      Intest Res : Intestinal Research
      Close layer
      TOP